Journal: Neuroscience Bulletin

Article Title: SOX11-mediated CBLN2 Upregulation Contributes to Neuropathic Pain through NF-κB-Driven Neuroinflammation in Dorsal Root Ganglia of Mice

doi: 10.1007/s12264-025-01530-0

Figure Lengend Snippet: SOX11 regulates the transcription of Cbln2 . A A cis -regulatory element analysis of the 2000-bp sequence (−1243 to +757) upstream of the Cbln2 translation initiation site using JASPAR software predicted 12 putative SOX11 binding sites. B Analysis of SOX11 and CBLN2 expression patterns in the harmonized DRG neuronal reference atlas. The two genes were co-expressed in the Ntrk3low + Ntrk2, Pvalb, and Ntrk3high + Ntrk2 neurons. C Dual-luciferase reporter assays demonstrated that SOX11 overexpression significantly enhanced Cbln2 promoter-driven reporter gene activity. D–E Representative blots and summarized ChIP-qPCR data demonstrate alterations in the binding of SOX11 with Cbln2 following SNL. Input, total purified fragments. Student’s unpaired t -test. Data are mean ± SEM of biological replicates n = 3, * P < 0.05 versus sham group. F Sox11 mRNA expression in DRG of naïve, sham-, and SNL-operated mice. ** P < 0.01, *** P < 0.001 vs. corresponding sham group, two-way ANOVA followed by Bonferroni’s test, n = 6 mice/group. G–H Western blot analysis showed increased SOX11 protein in DRG at 10 d post-SNL. ** P < 0.01 vs. sham, Student’s t -test, n = 3 mice/group. I Quantification of SOX11 co-localization with NF200, CGRP, and IB4 at 10 d post-SNL. J–N Immunofluorescence double-staining of SOX11/NF200 (J), SOX11/CGRP (K), SOX11/IB4 (L), SOX11/GS (M), and SOX11/IBA-1 (N) in the DRG at 10 d post-SNL.

Article Snippet: Sections were blocked with 1% BSA and incubated with the following primary antibodies: CBLN2 (Rabbit, 1:500; Invitrogen, PA5-101514, USA), neuronal class III β-tubulin (TUJ1; Mouse 1:1000; Millipore MAB1637, Germany), glutamine synthetase (GS; Mouse 1:500; Millipore MAB302, Germany), ionized calcium binding adapter molecule 1 (IBA-1; Goat, 1:500; Abcam ab5076, UK), 200 kDa neurofilament protein (NF200; Mouse, 1:1000; Millipore, MAB5266, Germany), calcitonin gene-related peptide (CGRP; Goat, 1:3000; Bio-Rad 1720-9007, USA), isolectin B4 (IB4; 1:50; Sigma L2895, USA), NF-κB p65 (Rabbit, 1:1000; CST, 8242S, USA), Phospho-NF-κB p65 (Rabbit, 1:1000; CST, 3033S, USA) and SOX11 (Rabbit, 1:50; MCE HY- P80332 , USA).

Techniques: Sequencing, Software, Binding Assay, Expressing, Luciferase, Over Expression, Activity Assay, ChIP-qPCR, Purification, Western Blot, Immunofluorescence, Double Staining

Journal: Neuroscience Bulletin

Article Title: SOX11-mediated CBLN2 Upregulation Contributes to Neuropathic Pain through NF-κB-Driven Neuroinflammation in Dorsal Root Ganglia of Mice

doi: 10.1007/s12264-025-01530-0

Figure Lengend Snippet: SOX11 and CBLN2 contribute to SNL-induced mechanical allodynia and thermal hyperalgesia. A Validation of Sox11 -targeting siRNA knockdown efficiency in Neuro-2a cells. siRNA-1, siRNA-2 and siRNA-3 significantly reduced Sox11 expression compared to the negative control. *** P < 0.001 vs. NC, one-way ANOVA followed by Bonferroni’s test, n = 6 wells/group. B–C Intrathecal delivery of Sox11 siRNA1 at 10 d post-SNL alleviated mechanical allodynia and thermal hyperalgesia 24 h post-injection. * P < 0.05 vs. NC siRNA; two-way ANOVA followed by Bonferroni’s test, n = 6 wells/group. D–E Sox11 siRNA-1 reduced Sox11 and Cbln2 expression. * P < 0.05, ** P < 0.01, Student’s t- test, n = 6 mice/group. F–G Intrathecal delivery of Cbln2 siRNA at 10 d post-SNL alleviated mechanical allodynia 24 h post-injection and thermal hyperalgesia 24–48 h post-injection. * P < 0.05, ** P < 0.01, *** P < 0.001 vs. NC, two-way ANOVA followed by Bonferroni’s test, n = 6 wells/group. H Cbln2 siRNA reduced Cbln2 expression. *** P < 0.001, Student’s t -test, n = 6 mice/group.

Article Snippet: Sections were blocked with 1% BSA and incubated with the following primary antibodies: CBLN2 (Rabbit, 1:500; Invitrogen, PA5-101514, USA), neuronal class III β-tubulin (TUJ1; Mouse 1:1000; Millipore MAB1637, Germany), glutamine synthetase (GS; Mouse 1:500; Millipore MAB302, Germany), ionized calcium binding adapter molecule 1 (IBA-1; Goat, 1:500; Abcam ab5076, UK), 200 kDa neurofilament protein (NF200; Mouse, 1:1000; Millipore, MAB5266, Germany), calcitonin gene-related peptide (CGRP; Goat, 1:3000; Bio-Rad 1720-9007, USA), isolectin B4 (IB4; 1:50; Sigma L2895, USA), NF-κB p65 (Rabbit, 1:1000; CST, 8242S, USA), Phospho-NF-κB p65 (Rabbit, 1:1000; CST, 3033S, USA) and SOX11 (Rabbit, 1:50; MCE HY- P80332 , USA).

Techniques: Biomarker Discovery, Knockdown, Expressing, Negative Control, Injection

Journal: Neuroscience Bulletin

Article Title: SOX11-mediated CBLN2 Upregulation Contributes to Neuropathic Pain through NF-κB-Driven Neuroinflammation in Dorsal Root Ganglia of Mice

doi: 10.1007/s12264-025-01530-0

Figure Lengend Snippet: NF-κB inhibitor and Sox11 siRNA decreased CBLN2-induced proinflammatory cytokines upregulation. A Intrathecal administration of CBLN2 upregulated mRNA levels of Cxcl2 , Cxcl3 , Cxcl9 , Ccl3 , and Ccl4 at 6 h post-CBLN2 administration. * P < 0.05, ** P < 0.01 vs. PBS, Student's t -test, n = 6 wells/group. B Pretreatment with PDTC reduced CBLN2-induced chemokine expression. * P < 0.05, ** P < 0.01, *** P < 0.001 vs. vehicle, Student's t -test, n = 6 wells/group. C Intrathecal delivery of Sox11 -targeting siRNA reduced the expression of these chemokines. * P < 0.05, ** P < 0.01, *** P < 0.001 vs. NC, Student's t -test, n = 6 wells/group.

Article Snippet: Sections were blocked with 1% BSA and incubated with the following primary antibodies: CBLN2 (Rabbit, 1:500; Invitrogen, PA5-101514, USA), neuronal class III β-tubulin (TUJ1; Mouse 1:1000; Millipore MAB1637, Germany), glutamine synthetase (GS; Mouse 1:500; Millipore MAB302, Germany), ionized calcium binding adapter molecule 1 (IBA-1; Goat, 1:500; Abcam ab5076, UK), 200 kDa neurofilament protein (NF200; Mouse, 1:1000; Millipore, MAB5266, Germany), calcitonin gene-related peptide (CGRP; Goat, 1:3000; Bio-Rad 1720-9007, USA), isolectin B4 (IB4; 1:50; Sigma L2895, USA), NF-κB p65 (Rabbit, 1:1000; CST, 8242S, USA), Phospho-NF-κB p65 (Rabbit, 1:1000; CST, 3033S, USA) and SOX11 (Rabbit, 1:50; MCE HY- P80332 , USA).

Techniques: Expressing

Journal: Investigative Ophthalmology & Visual Science

Article Title: The Impact of Aging and Sex on Corneal Nerve Density and Function

doi: 10.1167/iovs.67.3.3

Figure Lengend Snippet: The gene expression of neurotrophic and neuroregenerative markers is influenced by age and sex. ( A – F ) Quantification of SOX11 ( A ), GAP43 ( B ), BDNF ( C ), GDNF ( D ), NGF ( E ), and ATF3 ( F ) in the TG of male and female mice 8 and 52 weeks old ( n = 3–6 mice/group). The graphs represent mean values ± SEM. Statistical analysis was performed using unpaired Student's t -tests. * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: TaqMan Gene Expression Assays (Applied Biosystems, Foster City, CA, USA) for Tac1 (Mm01166996_m1), Tacr1 (Mm00436892_m1), Calca (Mm00801463_g1), Ramp1 (Mm00489796_m1), Sox11 (Mm01281943_s1), Gap43 (Mm00500404_m1), Gdnf (Mm00599849_m1), Atf3 (Mm00476033_m1), Trpv1 (Mm01246300_m1), Trpm8 (Mm01299593_m1), Piezo2 (Mm01265861_m1), Trpa1 (Mm01227437_m1), Ngf (Mm00443039_m1), Bdnf (Mm04230607_s1), and glyceraldehyde 3-phosphate dehydrogenase (Mm99999915_g1) as the housekeeping gene were performed.

Techniques: Gene Expression

Journal: Blood Advances

Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

doi: 10.1182/bloodadvances.2025016801

Figure Lengend Snippet: Genetic depletion of SOX11 reduced the expression of PAX5 and CD19. (A) CRISPR/Cas9- and short hairpin RNA (shRNA)-mediated knockdown of SOX11 resulted in reduced protein levels of PAX5 and CD19 in JeKo-1 and Z-138 cells. SCR refers to the scramble control; sg_SOX11 indicates guide RNAs C1 and C2; sh_SOX11 represents shRNA constructs C1 and C2, respectively. (B) Genetic knockdown of SOX11 led to reduced phosphorylation of downstream BCR signaling components. SOX11-deficient cells were stimulated with 5 μg/mL of IgM for 10 minutes, followed by immunoblot analysis of whole-cell lysates. (C) Overexpression of SOX11, tagged with 3XFlag, induces elevated levels of PAX5 and CD19 expression in the MAVER-1 and JeKo-1 cell lines. (D) Ectopic expression of SOX11 resulted in an increased level of PAX5 and CD19 in the SOX11-negative cell line JVM-2. Immunoblot experiments were performed to validate the results, and β-actin was used as a loading control to ensure equivalent loading and transfer. SCR, scramble control; sg_SOX11, guide RNAs C1 and C2; sh_SOX11, shRNA constructs C1 and C2.

Article Snippet: CRISPRevolution synthetic guide RNAs targeting SOX11 (sequence: CCGGGAGGCGCUGGACACGG) and negative control scrambled synthetic guide RNA were procured from Synthego.

Techniques: Expressing, CRISPR, shRNA, Knockdown, Control, Construct, Phospho-proteomics, Western Blot, Over Expression

Journal: Blood Advances

Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

doi: 10.1182/bloodadvances.2025016801

Figure Lengend Snippet: SOX11-PAX5-CD19 axis correlates with BTKi resistance in MCL. (A) Violin plot showing the relative expression levels of SOX11, PAX5, and CD19 in normal, BTKi-S, and BTKi-R MCL cell samples from the patients. Each dot represents an individual tumor B cell, with colors indicating clinical outcomes. (B) Scatter plot illustrates the correlation between SOX11 and PAX5 (left) and PAX5 and CD19 (right) in BTKi-S and BTKi-R MCL tumor B cells, respectively. A fitted line with 95% confidence intervals is shown. The correlation coefficient and P value are indicated on each plot. (C) SOX11, PAX5, and CD19 mRNA expression are positive correlates in patients’ tumor cells (n = 39, ECOG 1405 data sheets). (D) Immunoblot analysis showing the expression of SOX11, PAX5, and CD19 in primary cells from IBN-sensitive and IBN-resistant patients. β-Actin was used as a loading and transfer control. (E) Increased levels of PAX5 were observed in CD5 + , CD19 + , and CD23 – (B1a) PB mononuclear cells from Tg-SOX11 mice (n = 6) in comparison to WT mice (n = 5) controls. ∗∗, P < .001. ECOG, Eastern Cooperative Oncology Group.

Article Snippet: CRISPRevolution synthetic guide RNAs targeting SOX11 (sequence: CCGGGAGGCGCUGGACACGG) and negative control scrambled synthetic guide RNA were procured from Synthego.

Techniques: Expressing, Western Blot, Control, Comparison

Journal: Blood Advances

Article Title: SOX11 modulates BCR signaling through the PAX5/CD19 axis for therapeutic targeting in BTK-resistant mantle cell lymphoma

doi: 10.1182/bloodadvances.2025016801

Figure Lengend Snippet: CD19 regulates BCR signaling in a SOX11-dependent manner. (A) CRISPR/Cas9-mediated genetic depletion of CD19 decreased CD19 protein expression in JeKo-1 and Z-138 cells, along with (B) a reduction in the phosphorylation of BTK and AKT. Immunoblot experiments were performed to validate the results, whereas β-actin was assayed to ensure equivalent loading and transfer. (C) Immunoblot experiments were performed in PDX cells, with results indicating that high SOX11 expression leads to an increase in CD19 levels, leading to enhanced downstream BCR signaling. (D) Histograms depict the expression of B-cell and plasma cell surface markers (CD19, CD20, CD24, and CD138), as well as surface IgD and IgM, as measured by flow cytometry in SOX11 and CD19 knockout JeKo-1 cell lines, compared to that in the WT mice. CAR-T Res, CAR-T resistance; SCR, scramble control.

Article Snippet: CRISPRevolution synthetic guide RNAs targeting SOX11 (sequence: CCGGGAGGCGCUGGACACGG) and negative control scrambled synthetic guide RNA were procured from Synthego.

Techniques: CRISPR, Expressing, Phospho-proteomics, Western Blot, Clinical Proteomics, Flow Cytometry, Knock-Out, Control